Health Homozygous CCR5-∆32 is bad news for longevity

Angela

Elite member
Messages
21,823
Reaction score
12,329
Points
113
Ethnic group
Italian
See:
https://www.nature.com/articles/s41591-019-0459-6

My raw data at 23andme says it can't be found. Perhaps they don't test for it?

"We use the genotyping and death register information of 409,693 individuals of British ancestry to investigate fitness effects of the CCR5-∆32 mutation. We estimate a 21% increase in the all-cause mortality rate in individuals who are homozygous for the ∆32 allele. A deleterious effect of the ∆32/∆32 mutation is also independently supported by a significant deviation from the Hardy–Weinberg equilibrium (HWE) due to a deficiency of ∆32/∆32 individuals at the time of recruitment."
 
@Angela
Check/browse the i3003626 in 23andMe.

https://www.snpedia.com/index.php/Rs333

https://www.snpedia.com/index.php/I3003626

It seems (D,D) is more common in North Europe. If it's bad news for longevity, at least it potentially provides immunity against HIV and plague, if I get it right.
I'm (I,I), or GTCAGTATCAATTCTGGAAGAATTTCCAGACA / GTCAGTATCAATTCTGGAAGAATTTCCAGACA.

Thanks, Regio.

I can't understand what it's telling me.
CCR5i300362646414947— or GTCAGTATCAATTCTGGAAGAATTTCCAGACAGTCAGTATCAATTCTGGAAGAATTTCCAGACA / GTCAGTATCAATTCTGGAAGAATTTCCAGACA



I started going cross eyed, but I think we're the same, yes? Which means what? We don't carry the mutated version? Which means unless we're exposed to HIV or plague it's good news?

I think the likelihood I'll be exposed to either is small. :)
 
I'm homozygous [FONT=&quot][/FONT][FONT=&quot]GTCAGTATCAATTCTGGAAG AATTTCCAGACA / GTCAGTATCAATTCTGGAAGAATTTCCAGACA, ​so I guess the same as you guys.[/FONT]
 
Thanks, Regio.

I can't understand what it's telling me.
CCR5i300362646414947— or GTCAGTATCAATTCTGGAAGAATTTCCAGACAGTCAGTATCAATTCTGGAAGAATTTCCAGACA / GTCAGTATCAATTCTGGAAGAATTTCCAGACA



I started going cross eyed, but I think we're the same, yes? Which means what? We don't carry the mutated version? Which means unless we're exposed to HIV or plague it's good news?

I think the likelihood I'll be exposed to either is small. :)
Yes, same as mine. It means we don't have the mutation (deletion of 32-base-pair, hence the "delta"), which would affect longevity in a negative way. But it would indeed protect from HIV.

"CCR5 Δ32 is a 32-base-pair deletion that introduces a premature stop codon into the CCR5 receptor locus, resulting in a nonfunctional receptor. CCR5 is required for M-tropic HIV-1 virus entry. Individuals homozygous (denoted Δ32/Δ32) for CCR5 Δ32 do not express functional CCR5 receptors on their cell surfaces and are resistant to HIV-1 infection, despite multiple high-risk exposures."
https://en.wikipedia.org/wiki/CCR5

It was hypothesized far back, in 2001, that it was spread by Vikings, but I'm not sure it makes sense:
https://www.ncbi.nlm.nih.gov/pubmed/11543895

The likelihood I'll be exposed to it is small as well. I certainly prefer longevity, je je je.
 
Yes, same as mine. It means we don't have the mutation (deletion of 32-base-pair, hence the "delta"), which would affect longevity in a negative way. But it would indeed protect from HIV.
"CCR5 Δ32 is a 32-base-pair deletion that introduces a premature stop codon into the CCR5 receptor locus, resulting in a nonfunctional receptor. CCR5 is required for M-tropic HIV-1 virus entry. Individuals homozygous (denoted Δ32/Δ32) for CCR5 Δ32 do not express functional CCR5 receptors on their cell surfaces and are resistant to HIV-1 infection, despite multiple high-risk exposures."
https://en.wikipedia.org/wiki/CCR5
It was hypothesized far back, in 2001, that it was spread by Vikings, but I'm not sure it makes sense:
https://www.ncbi.nlm.nih.gov/pubmed/11543895
The likelihood I'll be exposed to it is small as well. I certainly prefer longevity, je je je.

Makes sense. About 90% of the population of the town of Fivizzano in the Lunigiana died of the plague during the Middle Ages.

Glad I'm living now. :)

I'm sure there are multiple reasons, but we do have a quite extraordinary percentage of the population who are over 90 years old.
 
It had been reported widely in the media at the time He Jiankui did his CRISPR CCR5 knockout
on the 2 or 3 IVF children that the double deletion of CCR5 might actually reduce fitness
and longevity.

A study came out saying that they had found an effect in UK.
CCR5-Δ32 is deleterious in the homozygous state in humans
Xinzhu Wei1 and Rasmus Nielsen

But now it appears that was just a technical error:

pmc articles PMC7302696

These analyses show that the original reports of a recessive deleterious effect of CCR5-Δ32 are affected by a technical artifact,
and that a closer investigation of the same data provides no positive evidence for an effect on lifespan.
 

This thread has been viewed 6310 times.

Back
Top